The Rockefeller University
Laboratory of Molecular Neuro-Oncology

RU Home  >  Research  >  Laboratory of Molecular Neuro-Oncology  >  Nova-Dependent Regulation of Brain-Specific Splicing
Exon Sequence
Gene symbol:Gphn
Locus ID:268566
Refseq ID:NM_172952
Gene Description:gephyrin
Gene ID:G6876303
Eex:(E4-E4a)
Eex Seq:AAACACTCATAGACTGGTGTGATGAAAAGGAACTTAATTT
AATATTAACAACTGGAGGAACGGGGTTTGCACCACGAGAT
GTCACTCCAGAGCCACAAAAGAAGTAATAGAGCGGGAAGC
GCCAGGGATGGCCCTGGCAATGCTGAT

Launch BLAT in a new window